#dnaday
These are public posts tagged with #dnaday. You can interact with them if you have an account anywhere in the fediverse.
#QuestionOfTheWeek: What are your DNA ethnicity estimates? Any surprises? Share your percentages & discoveries! Compare with relatives to break through brick walls.
https://www.youtube.com/watch?v=nwimjqnLbPw&list=PLEqK4ICkQWXQXODTRG6UGGZ4cmXiMRmD4
#DNADay
#CollaborativeGenealogy #AncestryDNA #23andMe #MyHeritage #FamilyTreeDNA #GEDMatch
catgcgccgccgtatgataacgcggatgcgtat
The #EJeanCarroll rape case against #DonaldTheDeplorable is underway.
Unfortunately, #Trump will not have his #DNAday 
in front of the judge and jury. 
https://vm.tiktok.com/ZTRTc7ema/
@npr 
How ‘bout “Don’t ask. Don’t tell.” Worked before!
Seriously, nobody cares about #ethnicity and there’s actually no such thing as race.
#Racism is real, but is it manufactured by our obsession with the toxic fantasy of race?
“Chemical Eye 
on the Race Factor” http://www.sitnews.us/MacDougall/102508_macdougall.html
Ketchikan, Alaska news. Southeast Alaska news, Alaska…
www.sitnews.us
️ @MU_Peter@mas.to#DNADay
What Rosalind Franklin truly contributed to the discovery of DNA’s structure
Franklin was no victim in how the DNA double helix was solved. An overlooked letter and an unpublished news article, both written in 1953, reveal that she was an equal player.
https://www.nature.com/articles/d41586-023-01313-5
h/t @darwinsbulldog
It's #DNADay and the 70th anniversary of the discovery of DNA's double helix structure. Here's a graphic which looks at it in detail https://www.compoundchem.com/2015/03/24/dna/
️ @MU_Peter@mas.toToday, April 25th is #DNADay
If you ask me... it's the perfect date.
https://www.youtube.com/watch?v=-BNwiqDGz5g
A single gram of DNA is capable of holding 700 terabytes of data, which means if you wanted to store all the digital information that exists in the world in DNA format, you'd only need two grams of it.
10 things you might not know about DNA:
https://topicaltens.blogspot.com/2017/04/25th-april-dna-day.html
Today is DNA day. Here are a few things you might…
topicaltens.blogspot.com5/5 Solving the mystery of DNA rings: Anton Henssen (@anton_gh, #mdcberlin & @ChariteBerlin) and scientists from 
and 
research the role that ring-shaped strands of DNA play in the development of #cancer, and how to fight them.
https://www.mdc-berlin.de/news/press/cancer-grand-challenge-henssen
Pediatric oncologist Anton Henssen and a group of researchers…
www.mdc-berlin.de4/5 Antibodies can "steal" pieces of other #genes: Kathrin de la Rosa (@berlinnovation) analyzes how the body creates a diverse set of #antibodies to fight off #infections. Her team reports: It's not just mutations @PNASNews
https://www.mdc-berlin.de/news/press/stolen-dna-strengthens-immune-diversity
To combat pathogens, the immune system needs an enormous…
www.mdc-berlin.de3/5 Abnormalities in DNA folding presumably cause learning disorders. Ana Pombo (@apombo1 / @BIMSB_MDC) and Alexander Kukalev have received a @dfg_public grant to test this hypothesis.
https://www.mdc-berlin.de/news/news/cracking-chromatin-code
Chromatin factors are involved in regulating gene expression.…
www.mdc-berlin.de2/5 The fins of skates: The key to their #evolution lies in the non-coding bits of the animals’ #genome and the 3D complexes it folds into: TADs. #mdcBerlin scientist @Dariloops (@BIMSB_MDC) is among the lead authors of the @Nature paper.
https://www.mdc-berlin.de/news/press/how-skates-learned-fly-through-water
#DNADay #DNADay23
Genes are not the only drivers of evolution. The iconic…
www.mdc-berlin.de
on our recent research on DNA 
@anton_gh
Happy #DNADay! Today we celebrate the incredible discovery of the DNA structure & its impact on science!
By studying mouse DNA, we unlock the secrets to human health, unravel complex diseases & fuel medical breakthroughs! 
Happy #DNADay! Today we celebrate the incredible discovery of the DNA structure & its impact on science!
By studying mouse DNA, we unlock the secrets to human health, unravel complex diseases & fuel medical breakthroughs!
#DNA sequencing technologies on a European level: On May 4, the @EasiGenomics Summit in Berlin will be a grand finale for the project!
Janine Altmüller (#mdcBerlin & @berlinnovation) is talking about the past 4 years: https://www.mdc-berlin.de/news/news/grand-finale-european-genome-project
EASI-Genomics, an EU-funded project designed to facilitate…
www.mdc-berlin.de️ @MU_Peter@mas.to#DNADay
Some genetic testing companies report how much DNA a person has inherited from prehistoric humans, such as Neanderthals and Denisovans.
Here are some guidelines about that:
What does it mean to have Neanderthal or Denisovan DNA?
https://medlineplus.gov/genetics/understanding/dtcgenetictesting/neanderthaldna/
️ @MU_Peter@mas.to#DNADay
We think of chromosome machinery ensuring unbiased, random segregation.
However...
A more complete understanding of nonrandom segregation may shed light on how speciation occurs.
Probing Centromeres Unveils an Evolutionary Arms Race
https://www.the-scientist.com/features/probing-selfish-centromeres-unveils-an-evolutionary-arms-race-71017
