Clara Listensprechen @ClaraListensprechen4@qoto.org

#MedicateASong
#HashtagGames

"DayQuil Believer"

https://www.youtube.com/watch?v=xvqeSJlgaNk

Tylenol a Yellow Ribbon 'Round the Old Oak Tree
#MedicateASong
#HashTagGames

Codeine, Codeine, Codeine, Codeine
I’m begging you please don’t take my man

#MedicateASong 
#HashtagGames

#medicateasong The Pharma in the Dell

There's Got to be a Morning After 💊

#MedicateASong
#HashTagGames

All My Mucinexes Live in Texas

#MedicateASong #HashTagGames #AllMyExesLiveInTexas #GeorgeStrait @hashtaggames

🎶 Proud Moderna ~Tina Turner

#MedicateASong
#HashTagGames

https://www.youtube.com/watch?v=TTfYnRQgKgY

Fields of Gold Bond

#MedicateASong #HashTagGames #FieldsOfGold #Sting #GoldBond @hashtaggames

#MedicateASong nights in white statins

We Didn’t Start The Pfizer

#MedicateASong #HashTagGames #BillyJoel @hashtaggames

A colleague apparently has Siri read his Slack messages to him. Earlier today he asked me for some oligo sequences and he reports that Siri trying to say "GCATTCGGGATATTAACGAGGC" is hilarious.

Construction on new central Saskatoon library delayed due to costs https://saskatoon.ctvnews.ca/construction-on-new-central-saskatoon-library-delayed-due-to-costs-1.6561932

Construction on Saskatoon's new downtown library has been delayed after bids for the project came in over its $134 million budget.

ICYMI: #News #TopStories Wisconsin’s elder care facilities face staffing, financial challenges that threaten care https://wausaupilotandreview.com/2023/09/12/wisconsins-elder-care-facilities-face-staffing-financial-challenges-that-threaten-care/?utm_source=dlvr.it&utm_medium=mastodon

Pelosi mocks McCarthy's 'ever incredibly shrinking speakership' - POLITICO

https://www.politico.com/news/2023/09/13/pelosi-mocks-mccarthys-ever-incredibly-shrinking-speakership-00115841

N. Korea reaches 'satisfactory agreement' with Russia at summit https://mainichi.jp/english/articles/20230914/p2g/00m/0in/016000c

ICYMI: #Milestones #afternoonupdate Today in History: September 12, Voyager 1 becomes first man-made object to leave the solar system https://wausaupilotandreview.com/2023/09/12/today-in-history-september-12-voyager-1-becomes-first-man-made-object-to-leave-the-solar-system/?utm_source=dlvr.it&utm_medium=mastodon